pGB expression vector to supress BID apoptotic activity in transfected cells.
- Features and Positions:
- Human U6 Promoter: 1-256
- Multiple cloning Site: 259-285
- 3’ Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG)
- SV40 Promoter: 470-808
- Neomycin/Kanamycin Resistance ORF: 843-1634
- 5’ Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG)
pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. In addition, pGB Cloning vector which is used to clone your own insert and pGB Negative Control vector which contains an insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and therefore can be used as a negative control for pGB-expression vectors. The pGB siRNA vectors are designed to suppress the expression of some of the most important apoptosis genes, individually. The mix of four siRNA vectors for each gene has been proven more efficient for gene suppression.